jurkat atcc cat (ATCC)

ATCC is a verified supplier

ATCC manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

ATCC jurkat atcc cat
Jurkat Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 4461 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/jurkat+atcc+cat/Jurkat%2C+Clone+E6-1/pm42268711-155-24-25
Average 99 stars, based on 4461 article reviews

jurkat atcc cat - by Bioz Stars, 2026-09

99/100 stars

Images

Multiple Displacement Amplification:

Article Title: Lymph node macrophages drive immune tolerance and resistance to cancer therapy by induction of the immune-regulatory cytokine IL-33.
Article Snippet: In brief Although immunity is an important component of cancer therapy responses, suppressive immune feedback restricting anti-tumor activity has not been extensively examined.. In this issue of Cancer Cell, Lamorte et al. identify expression of the cytokine IL-33 by lymph node macrophages after therapy as an important inhibitor of therapeutic efficacy.. Notably, antagonizing IL-33 function significantly increases therapeutic responses to chemoand targeted-therapy revealing IL-33 responses as an actionable target to augment anti-tumor immunity when chemotherapy or other therapeutic modalities are employed.

Knock-In:

Knock-Out:

other:

Article Title: Phosphorylation-Mediated IFN-γR2 Membrane Translocation Is Required to Activate Macrophage Innate Response.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Primer: Sele (Fw): 50- GTCTAGCGCCTGGATGAAAG 30 Sangon Biotech N/A Primer: Sele (Rev): 50- ATTGCCACCAGATGTGTGTA 30 Sangon Biotech N/A Primer: Tnfa (Fw): 50- AAGCCTGTAGCCCACGTCGTA 30 Sangon Biotech N/A Primer: Tnfa (Rev): 50-GCCACCACTAGTTGGTTGTC TTTG 30 Sangon Biotech N/A Primer: Il6 (Fw): 50- TAGTCCTTCCTACCCCAATTTCC 30 Sangon Biotech N/A Primer: Il6 (Rev): 50- TTGGTCCTTAGCCACTCCTTC 30 Sangon Biotech N/A Primer: Ifngr2 KO (Fw): 50- TGATTTGTGGCTCTCA GGG 30 Sangon Biotech N/A Primer:Ifngr2 KO (Rev): 50- AGATGAGCAGGAGGT GATG 30 Sangon Biotech N/A Recombinant DNA Plasmid: pcDNA3.1-myc Invitrogen Cat #V855-20 Plasmid: pcDNA3.1-flag This paper N/A Plasmid: pcDNA3.1-ha This paper N/A Plasmid: pcDNA3.1-Btk-ha This paper N/A Plasmid: pcDNA3.1-BtkK42R-ha This paper N/A Plasmid: pcDNA3.1-Ifngr2-myc This paper N/A Plasmid: pcDNA3.1-Ifngr2Y289A-myc This paper N/A Plasmid: pcDNA3.1-Efhd2-flag This paper N/A Plasmid: pGL3-U6-sgRNA-PGK-puromycin Addgene Cat #51133 Plasmid:pST1347-NLS-flag-linker-Cas9 Addgene N/A Software and Algorithms FACSDiva software BD Bioscience http://www.bdbiosciences.com/us/ instruments/research/software/flowcytometry-acquisition/bd-facsdivasoftware/m/111112/overview ImageJ NIH https://imagej.nih.gov/ij/download.html FV10-ASW 3.0 Viewer PHOTONICS MEDIA https://www.photonics.com/Product. aspx?PRID=47380 ZEN lite software ZEISS https://www.zeiss.com/microscopy/ int/products/microscope-software/ zen-lite.html Other Kinase buffer Cell signaling Technology Cat #9802 Please cite this article in press as: Xu et al., Phosphorylation-Mediated IFN-gR2 Membrane Translocation Is Required to Activate Macrophage Innate Response, Cell (2018), https://doi.org/10.1016/j.cell.2018.09.011

Article Title: A nanobody-based tri-specific NK cell engager targeting CD5 triggers antitumor immunity.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER 293 TM Freestyle medium Gibco Cat#C12338018 X-VIVO 15 TM medium Lonza Cat#BEBP02-054Q BSA BioFROXX Cat#4240GR005 CytoSinct TM CD3 Nanobeads, human Genescript Cat#L00896 CytoSinct TM CD56 Nanobeads, human Genescript Cat#L00903 hIL-2 T&L Biotechnology Cat#TL-104 hIL-15 Miltenyi Biotec Cat#130-095-765 hIL-7 Miltenyi Biotec Cat#130-095-362 Complete Freund’s Adjuvant Thermo Cat#77140 Incomplete Freund’s Adjuvant Thermo Cat#77145 CD5-ECD This paper N/A NKP46-ECD This paper N/A CD16a (158V)-ECD This paper N/A CD16a (158F)-ECD This paper N/A CD16b (NA1)-ECD This paper N/A CD16b (NA2)-ECD This paper N/A CD5-mFc This paper N/A Critical commercial assays Zombie NIR TM Fixable Viability kit Biolegend Cat#423105 ClonExpress II One Step Cloning Kit Vazyme Catalog#C112-01 RNeasy Plus Mini Kit QIAGEN Catalog#74143 QIAquick Gel Extraction Kit QIAGEN Catalog# 28706 One-Step gDNA Removal and cDNA Synthesis SuperMix TransScript Cat#AT311-02 Steady-Glo® Luciferase Assay System Promega Cat#E2510 Human Granzyme B ELISA kit Thermo Cat#BMS2027-2 Human TNF alpha ELISA Kit Thermo Cat#KHC3014 Human IFN gamma ELISA Kit Thermo Cat#KHC4021 Human IL-6 ELISA Kit Thermo Cat#BMS213-2TEN Dynabeads Human T-Activator CD3/CD28 Miltenyi Biotec Cat#130-128-758 Deposited data Raw data files for RNAseq This paper SRA: PRJNA1260153 Experimental models: Cell lines SP2/0 ATCC Cat#CRL-8287 HEK293T ATCC Cat#CRL-1573 HeLa ATCC Cat#CRM-CCL-2 CCRF-CEM ATCC Cat#CRM-CCL-119 MOLT-4 ATCC Cat#CRL1582 Jurkat ATCC Cat#TIB-152 Raji ATCC Cat#CCL-86 Sup-T1 ATCC Cat#CRL-1942 MAVER-1 ATCC Cat# CRL-3008 Experimental models: Organisms/strains Balb/c mice GemPharmatech N/A NSG mice GemPharmatech N/A Recombinant DNA pCDA3.1 Invitrogen Cat#V79020 pVAX1 Invitrogen Cat#V26020 (Continued on next page) e3 Cell Reports Medicine 6, 102409, October 21, 2025

Silver Staining:

Article Title: PNPT1 Release from Mitochondria during Apoptosis Triggers Decay of Poly(A) RNAs.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-Actin Developmental Studies Hybridoma Bank Cat#JLA20-c; RRID: AB_528068 Goat polyclonal anti-VDAC1 Santa Cruz Cat#sc-8828; RRID: AB_793935 Mouse monoclonal anti-Cytochrome c BioLegend Cat#612504; RRID: AB_2292697 Rabbit polyclonal anti-Caspase 3 Cell Signaling Cat#9661; RRID: AB_2341188 Rabbit polyclonal anti-Caspase 9 Cell Signaling Cat#9502; RRID: AB_10693286 Mouse polyclonal anti-DIS3L1 Abcam Cat#ab89042; RRID: AB_2040576 Rabbit polyclonal anti-DIS3L2 Novus Cat#NBP1-84740; RRID: AB_11038956 Mouse monoclonal anti-PABPC1 Sigma Cat#P6246; RRID: AB_2251741 Rabbit polyclonal anti-PABPC1 Abcam Cat#ab21060; RRID: AB_777008 Rabbit polyclonal anti-PNPT1 Abcam Cat#ab96176; RRID: AB_10680559 Mouse Anti-Cleaved PARP (Asp214) BD PharMingen Cat#552597; Mouse monoclonal anti-Fas antibody (clone CH11) Millipore Cat#05-201; RRID:AB_309653 Chemicals, Peptides, and Recombinant Proteins Superkiller TRAIL Enzo Life Sciences Cat#ALX-201-115-C010 Staurosporine Cell Signaling Cat#9953 Thapsigargin Sigma Cat#T9033-.5MG Etoposide Sigma Cat#E1383-25MG a-amanitin Sigma Cat#A2263-1MG Cycloheximide Sigma-Aldrich Cat#C104450 Puromycin Sigma-Aldrich Cat#P9620 z-VAD-fmk BD Cat#550377 M-CSF R&D Systems 416-ML-010 t-Bid ProSpec Cat#pro-644 Complete Protease Inhibitor Cocktail Sigma-Aldrich Cat# 04693159001 RNaseOUT ThermoFisher Scientific Cat#10777019 RNase A ThermoFisher Scientific Cat#EN0531 100x Halt Phosphatase Inhibitor Cocktail ThermoFisher Scientific Cat#78420 100x ReadyStrip pH 7-10 buffer Bio-Rad Cat#1632093 7cm pH 3-10 ReadyStrip IPG strips Bio-Rad Cat#1632000 MitoTracker Red Invitrogen Cat#M22426 Critical Commercial Assays Lipofectamine RNAiMAX Life Technologies Cat#13778-075 Lipofectamine 2000 ThermoFisher Scientific Cat#11668019 NEBNext Ultra RNA Library Prep Kit NEB Cat#E7530S Ribo-Zero Illumina Cat#MRZH116 CellTiter-Glo Luminescent Cell Viability Assay Promega Cat#G7570 SP6 mMESSAGE mMACHINE kit Ambion Cat#AM1340 SP6 MEGAscript kit Ambion Cat#AM1330 Protein G Dynabeads ThermoFisher Scientific Cat#10003D DNA-free kit Life Technologies Cat#AM1906 iScript RT reagent BioRad Cat#1708841 SuperScript III ThermoFisher Scientific Cat#18080044 (Continued on next page) e1 Cell 174, 1–15.e1–e6, June 28, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER SsoFast reagent BioRad Cat#172-5204 SilverQuest Silver Staining Kit ThermoFisher Scientific Cat#LC6070 2-D Clean-Up Kit GE Healthcare Cat#80648451 Deposited Data Data reported in this paper This paper GEO: GSE104602 Experimental Models: Cell Lines Human: HCT116 ATCC Cat#CCL-247 Human: HeLa ATCC Cat#CCL-2 Human: YT Indy Montel et al., 1995 N/A Human: Jurkat ATCC CatTIB-152 Human: H9 ATCC Cat#HTB-176 Experimental Models: Organisms/Strains C57BL/6J The Jackson Laboratory Cat#000664 Oligonucleotides Silencer Negative Control No. 1 ThermoFisher Scientific Cat#4390843 PNPT1 siRNA ThermoFisher Scientific Cat#s40091 PNPT1 siRNA ThermoFisher Scientific Cat#s40092 Pnpt1 siRNA ThermoFisher Scientific Cat#S232318 DIS3 siRNA ThermoFisher Scientific Cat#s229659 DIS3L1 siRNA ThermoFisher Scientific Cat#s41866 DIS3L2 siRNA ThermoFisher Scientific Cat#s43419 poly(A) oligonucleotide GE Healthcare Cat#27411001 qRT-PCR primers, see Table S2 This paper N/A Recombinant DNA pSP64poly(A) Promega Cat#P1241 Software and Algorithms RSeQC Wang et al., 2012 RRID: SCR_005275; https://sourceforge.net/projects/rseqc/ TopHat2 Kim et al., 2013 RRID: SCR_013035; http://tophat.cbcb.umd.edu/ HTSeq Anders et al., 2015 RRID: SCR_005514; http://htseq.readthedocs.io/en/release_0.9.1/ DESeq2 Love et al., 2014 RRID: SCR_015687; https://bioconductor.org/packages/release/ bioc/html/DESeq2.html SAMtools Li et al., 2009 RRID: SCR_002105; http://samtools.sourceforge.net/ R R Development Core Team, 2016 RRID: SCR_001905; http://www.r-project.org/ Python Python Software Foundation RRID: SCR_008394; https://www.python.org/ Please cite this article in press as: Liu et al., PNPT1 Release from Mitochondria during Apoptosis Triggers Decay of Poly(A) RNAs, Cell (2018), https://doi.org/10.1016/j.cell.2018.04.017 ..

Negative Control:

Quantitative RT-PCR:

Recombinant:

Article Title: Identification of the Nicotinamide Salvage Pathway as a New Toxification Route for Antimetabolites.
Article Snippet: Cat#354234 NAD Sigma-Aldrich Cat#N3014 NADH Sigma-Aldrich Cat#N8129 ATP Sigma-Aldrich Cat#A2383 GLUCOSE [U-14C] Perkin Elmer Cat#NEC042V250UC TMRE Sigma-Aldrich Cat#87917 FCCP Sigma-Aldrich Cat#C2920 Nicotinamide Mononucleotide (NMN) Sigma-Aldrich Cat#N3501 Nicotinamide Riboside (NR) ChromaDex Cat#ASB-00014314 Nicotinamide (NAM) Sigma-Aldrich Cat#72340 5-Phospho-D-ribose 1-diphosphate (PRPP) Sigma-Aldrich Cat#P8296 Inosine 5’-monophosphate Sigma-Aldrich Cat#57510 DL-Glyceraldehyde 3’-phosphate Sigma-Aldrich Cat#G5251 Trizol Reagent ThermoFisher Cat#15596026 iScript BioRad Cat#1708890 SYBR Green PCR kit BioRad Cat#1725271 Bovine Serum Albumin (BSA) Sigma-Aldrich Cat#A7906 Bovine Serum Albumin (BSA for cycling assay) Sigma-Aldrich Cat#A8531-1VL Riboflavin 50-monophosphate (FMN) Sigma-Aldrich Cat#F8399 Resazurin Sigma-Aldrich Cat#R7017 Isopropyl b-D-1-thiogalactopyranoside (IPTG) Sigma-Aldrich Cat#I6758 Tris(2-carboxyethyl)phosphine HCl (TCEP) Sigma-Aldrich Cat#75259 3-([3-Cholamidopropyl]dimethylammonio)-2-hydroxy1-propanesulfonate (CHAPSO) Sigma-Aldrich Cat#C3649 DL-Dithiothreitol Sigma-Aldrich Cat#43819 Phenylmethanesulfonyl fluoride (PMSF) Fluka Cat#78830 Protease Inhibitor Cocktail Sigma-Aldrich Cat#P8849 Ampicillin Sigma-Aldrich Cat#A9518 Kanamycin Sigma-Aldrich Cat#K4000 HisTrap HP column GE Healthcare Cat#17-5247-01 PD-10 desalting columns (Sephadex G-25) GE Healthcare Cat#17-0851-01 PD MiniTrap (Sephadex )G-25 GE Healthcare Cat#28-9180-07 Supelcosil LC-18-S HPLC column Supelco (Sigma-Aldrich) Cat#58928-U Supelcosil LC-18-T HPLC column Supelco (Sigma-Aldrich) Cat#58971 (Continued on next page) Cell Chemical Biology 25, 1–12.e1–e7, April 19, 2018 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Kinetex 2.6 mm C18 100A Phenomenex Cat#00F-4462-E0 Kinetex 2.6 mm HILIC 100A Phenomenex Cat#00F-4461-E0 TRACER EXTRASIL ODS2 5 mm Phenomenex Cat#N34544 Glyceraldehyde-3-phosphate Dehydrogenase Sigma-Aldrich Cat#G9263 Inosine Monophosphate Dehydrogenase Type II human Sigma-Aldrich Cat#I1782 Diaphorase from Clostridium kluyveri Sigma-Aldrich Cat#D5540 pET15b vector Novagen, EMD Millipore Cat#69661-3 Recombinant Human NAMPT This study N/A pTrcHisA- NMNAT1 Sorci et al., 2007 N/A pET28c- NMNAT2 Brunetti et al., 2010 N/A pTrcHisA- NMNAT3 Sorci et al., 2007 N/A Recombinant E.coli NMN deamidase (PncC) Zamporlini et al., 2014 N/A Recombinant B. anthracis NaMN adenylyltransferase (NadD) Zamporlini et al., 2014 N/A Recombinant B. anthracis NAD synthetase (NadE) Zamporlini et al., 2014 N/A a-cyano-hydroxycynnamic acid Sigma-Aldrich Cat#C2020 Aniline Sigma-Aldrich Cat#51788 9-aminoacridine Sigma-Aldrich Cat#92817 Oligonucleotides Oligonucleotides used, see Table S1 This study N/A Bacterial strains One Shot BL21 Star (DE3) Chemically Competent E.coli cells Invitrogen Cat#440049 One Shot TOP 10 Chemically Competent E.coli cells Invitrogen Cat#404003 Critical Commercial Assays ATPlite Luminescence Assay Perkin Elmer Cat#6016943 Bradford Protein Assay BioRad Cat#5000201 Lactate assay kit BioVision Cat#K607 Human NMNAT2 This study UniProtKB/Swiss-Prot: Q9BZQ4.1 Experimental Models: Cell Lines SH-SY5Y ATCC Cat#CRL-2266 HeLa ATCC Cat#CCL-2 INS-1 ATCC Cat#CRL-2057 SK-Hep-1 ATCC Cat#HTB-52 C6 ATCC Cat#CCL-107 NCI-H295R ATCC Cat#CRL-2128 CAPAN-1 ATCC Cat#HTB-79 JURKAT ATCC CatTIB-152 MeWo ATCC Cat#HTB-65 A375 ATCC Cat#CRL-1619 SK-Mel-2 CRL-ITT, Pisa N/A SK-Mel-5 CRL-ITT, Pisa N/A SK-Mel-28 CRL-ITT, Pisa N/A M26C CRL-ITT, Florence N/A M33x CRL-ITT, Florence N/A U937 ATCC Cat#CRL-1593 Experimental Models: Organisms/Strains Athymic nude mice (Foxn1 nu/nu) Envigo N/A (Continued on next page) e2 Cell Chemical Biology 25, 1–12.e1–e7, April 19, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and Algorithms VegaZZ Drug Design Laboratory http://www.vegazz.net I-TASSER Zhang Lab http://zhanglab.ccmb.med.umich.edu/ I-TASSER Verify_3D UCLA- DOE LAB http://services.mbi.ucla.edu/Verify_3D/ Thermo ImageQuest ThermoFisher Cat#10137985 GraphPad Prism version 7.00 for Windows GraphPad Software https://www.graphpad.com/

Software:

Hydrophilic Interaction Liquid Chromatography:

Luminescence Assay:

Bradford Protein Assay:

Lactate Assay:

Mass Spectrometry:

Article Title: NAMPT-targeting PROTAC and nicotinic acid co-administration elicit safe and robust anti-tumor efficacy in NAPRT-deficient pan-cancers.
Article Snippet: Article NAMPT-targeting PROTAC and nicotinic acid co- administration elicit safe and robust anti-tumor efficacy in NAPRT-deficient pan-cancers

Generated:

Article Title: Peptide-MHC-targeted engineered virus-like particles enable selective priming and gene editing of tumor-specific T cells.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Stop Solution for TMB Substrate Biolegend Cat#423001 Experimental models: Cell lines HEK293T ATCC Cat#CRL-3216 Gesicle Producer 293T Takara Cat632617 Jurkat ATCC Cat#TIB-152 TCR-expressing Jurkats Generated in this study. ..

Review